| BalID | 101 |
| Mirtron name | mir-702 |
| Species | M. Musculus |
| Mirtron Type | precursor |
| Mature 3' | - |
| Mature 5' | - |
| Chromosome | 5 |
| Start Sequence | 137020287 |
| End Sequence | 137020395 |
| Strand | + |
| Sequence | CGGGACAAGGUGAGUGGGGUGGUUGGCAUGGGUUGCCCAUGGGGACUCGACGCUGUGCCCACAGCCUCCUGAUGUCCUCCUCACGCAUGCCCACCCUUUACCCCUC |
| Host Gene | PLOD3 |
| Source | |
| Other info | |
| Paper | Alternative splicing of a viral mirtron differentially affects the expression of other microRNAs from its cluster and of the host transcript |