| BalID | 102 |
| Mirtron name | mmu-3547-3p |
| Species | M. Musculus |
| Mirtron Type | mature |
| Hairpin Arm | 3p |
| Mature 3' | - |
| Mature 5' | - |
| Chromosome | tbu |
| Start Sequence | tbu |
| End Sequence | tbu |
| Strand | tbu |
| Sequence | TGAGCACCACCCCTCTCTCAG |
| Host Gene | tbu |
| Source | |
| Other info | |
| Paper | Alternative splicing of a viral mirtron differentially affects the expression of other microRNAs from its cluster and of the host transcript |