| BalID | 104 |
| Mirtron name | mmu-mir-6927-3p |
| Species | M. Musculus |
| Mirtron Type | mature |
| Hairpin Arm | 3p |
| Mature 3' | - |
| Mature 5' | - |
| Chromosome | 11 |
| Start Sequence | 97567932 |
| End Sequence | 97567952 |
| Strand | + |
| Sequence | GAGAUCCCUGCGAAAUGACAG |
| Host Gene | MLLT6 |
| Source | |
| Other info | |
| Paper | Alternative splicing of a viral mirtron differentially affects the expression of other microRNAs from its cluster and of the host transcript |